nuclease free duplex buffer (Danaher Inc)
Danaher Inc is a verified supplier 
Danaher Inc manufactures this product 
86
Structured Review
Danaher Inc
nuclease free duplex buffer
Nuclease Free Duplex Buffer, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/duplex+buffer/pmc11379711-398-8-11
Average 86 stars, based on 1 article reviews
Nuclease Free Duplex Buffer, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/duplex+buffer/pmc11379711-398-8-11
Average 86 stars, based on 1 article reviews
nuclease free duplex buffer - by Bioz Stars,
2026-10
86/100 stars
Images
Related Articles
CRISPR:Article Title: Tumor Regression Following Engineered Polyomavirus-Specific T Cell Therapy in Immune Checkpoint Inhibitor-Refractory Merkel Cell Carcinoma Article Snippet: .. 0.625 μL each of 160 μM clustered regularly interspersed short palindromic repeats (crispr) RNAs targeting TRAC (AGAGTCTCTCAGCTGGTACA, IDT) and TRBC1/2 (GGAGAATGACGAGTGGACCC, IDT) were duplexed with 1.25 μL of tracrRNAs (IDT) in Article Title: Enhanced detection for antibiotic resistance genes in wastewater samples using CRISPR-enriched metagenomic method Article Snippet: .. Right before CRISPR-NGS library preparation, crRNA and tracrRNA were mixed equimolarly with the final concentration adjusted by Article Title: Optimized PAR-2 RING dimerization mediates cooperative and selective membrane binding for robust cell polarity. Article Snippet: Cell polarity networks are defined by quantitative features of their constituent feedback circuits, which must be tuned to enable robust and stable polarization, while also ensuring that networks remain responsive to dynamically changing cellular states and/or spatial cues during development.. Using the PAR polarity network as a model, we demonstrate that these features are enabled by the dimerization of the polarity protein PAR-2 via its N-terminal RING domain.. Combining theory and experiment, we show that dimer affinity is optimized to achieve dynamic, selective, and cooperative binding of PAR-2 to the plasma membrane during polarization. Concentration Assay:Article Title: Enhanced detection for antibiotic resistance genes in wastewater samples using CRISPR-enriched metagenomic method Article Snippet: .. Right before CRISPR-NGS library preparation, crRNA and tracrRNA were mixed equimolarly with the final concentration adjusted by Article Title: Single-cell analysis of innate spinal cord regeneration identifies intersecting modes of neuronal repair Article Snippet: Cas9 nuclease V3 (IDT, Cat# 1081059) was diluted in Cas9 dilution buffer (1 M HEPES at pH 7.5, 2 M KCl) to a working concentration of 25 μM. .. Annealed dgRNA duplexes were diluted 1:1 in other:Article Title: Single-cell analysis of innate spinal cord regeneration identifies intersecting modes of neuronal repair. Article Snippet: For both sets of tracing experiments, Biocytin-soaked Gelfoam Gelatin Sponge was applied at the new injury site (Gelfoam, Pfizer, cat# 09-0315-08; Biocytin, saturated solution, Sigma, Cat# B4261). Transfection:Article Title: Transcription of HIV-1 at sites of intact latent provirus integration Article Snippet: Primary CD4 + T cells were enriched from healthy donor cryopreserved PBMCs by negative selection (CD4 + T Cell Isolation Kit human, cat. 130-096-533; Miltenyi Biotec) and activated for 72 h with 10 μg/ml of plate-bound Ultra-LEAF purified anti-human CD3 monoclonal antibody (clone OKT3, cat. 317325; BioLegend) and 5 μg/ml of soluble Ultra-LEAF purified anti-human CD28 monoclonal antibody (clone 28.2, cat. 302933; BioLegend) in R10 medium (RPMI-1640 medium supplemented with 10% heat-inactivated FBS, 10 mM Hepes, antibiotic-antimycotic (1×) and 2 mM L -glutamine [all from Gibco]) supplemented with recombinant human IL-2 (50 U/ml; cat. 10799068001; Roche). .. For a 100 μl transfection, 1 μl of 200 μM of gene-specific crRNA and 1 μl 200 μM trans-activating crRNA (tracrRNA) in Mutagenesis:Article Title: Optimized PAR-2 RING dimerization mediates cooperative and selective membrane binding for robust cell polarity. Article Snippet: Cell polarity networks are defined by quantitative features of their constituent feedback circuits, which must be tuned to enable robust and stable polarization, while also ensuring that networks remain responsive to dynamically changing cellular states and/or spatial cues during development.. Using the PAR polarity network as a model, we demonstrate that these features are enabled by the dimerization of the polarity protein PAR-2 via its N-terminal RING domain.. Combining theory and experiment, we show that dimer affinity is optimized to achieve dynamic, selective, and cooperative binding of PAR-2 to the plasma membrane during polarization. Injection:Article Title: Optimized PAR-2 RING dimerization mediates cooperative and selective membrane binding for robust cell polarity. Article Snippet: Cell polarity networks are defined by quantitative features of their constituent feedback circuits, which must be tuned to enable robust and stable polarization, while also ensuring that networks remain responsive to dynamically changing cellular states and/or spatial cues during development.. Using the PAR polarity network as a model, we demonstrate that these features are enabled by the dimerization of the polarity protein PAR-2 via its N-terminal RING domain.. Combining theory and experiment, we show that dimer affinity is optimized to achieve dynamic, selective, and cooperative binding of PAR-2 to the plasma membrane during polarization. |